View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_low_22 (Length: 230)
Name: NF1455_low_22
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 49893707 - 49893919
Alignment:
| Q |
18 |
ctttgggtgctgccggattcatatcttgatgttcctaacaaggattatggaggtgagtggagttgtttaaactaagagcttggttaattgttacatcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49893707 |
ctttgggtgctgccggattcatatcttgatgttcctaacaaggattatggaggtgagtggagttgtttaaactaagagcttggttaattgttacatcatt |
49893806 |
T |
|
| Q |
118 |
gtttgttgtcttgaccactctcggggaatttcaggtgatttgtttgttgatgggaaagtaattcctaggccacaatatagatatgctgaaagggcaccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49893807 |
gtttgttgtcttgaccactctcggggaatttcaggtgatttgtttgttgatgggaaagtaattcctaggccacaatatagatatgctgaaagggcaccaa |
49893906 |
T |
|
| Q |
218 |
gtagaaatagacc |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49893907 |
gtagaaatagacc |
49893919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University