View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_low_25 (Length: 218)
Name: NF1455_low_25
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 72 - 196
Target Start/End: Original strand, 16072442 - 16072566
Alignment:
| Q |
72 |
tttatgcagcaactgattcaacaatctagtcacatgaagtttatccaannnnnnngttattgctatgatctctctcaaccaatctttaatctttttcacc |
171 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16072442 |
tttatgcagaaactgattcaacaatctagtcacatgaagtttatccaatttttttgttattgctatgatctctctcaaccaatctttaatctttttcacc |
16072541 |
T |
|
| Q |
172 |
atgtcacggttgaggatcgctcgaa |
196 |
Q |
| |
|
||||||||||||||| || |||||| |
|
|
| T |
16072542 |
atgtcacggttgaggctccctcgaa |
16072566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University