View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1455_low_26 (Length: 206)

Name: NF1455_low_26
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1455_low_26
NF1455_low_26
[»] chr5 (2 HSPs)
chr5 (68-189)||(31931358-31931479)
chr5 (1-44)||(31931503-31931546)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 31931479 - 31931358
Alignment:
68 tgtcagctttattcatatatagttgaattattgagaaaatgaggacctaaaaggtacatttttcctgcacattttcaccccccacatttcttatatcact 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31931479 tgtcagctttattcatatatagttgaattattgagaaaatgaggacctaaaaggtacatttttcctgcacattttcaccccccacatttcttatatcact 31931380  T
168 atcataggtctagaagtggtgg 189  Q
    ||||||||||||||||||||||    
31931379 atcataggtctagaagtggtgg 31931358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 31931546 - 31931503
Alignment:
1 cacatggtcgaacagattcttgtgtcaaaatcaaataaactcat 44  Q
    ||||||||||| ||||||||||||||||||||||||||||||||    
31931546 cacatggtcgatcagattcttgtgtcaaaatcaaataaactcat 31931503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University