View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14560_high_10 (Length: 252)

Name: NF14560_high_10
Description: NF14560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14560_high_10
NF14560_high_10
[»] chr3 (2 HSPs)
chr3 (131-252)||(48288837-48288958)
chr3 (30-62)||(48288986-48289018)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 131 - 252
Target Start/End: Complemental strand, 48288958 - 48288837
Alignment:
131 tttatgttaattgagagaatttccaatttgattacaggaactactataggtgttcagcggatggatgccaagtgaaaaagagagttgagagagatgtgga 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48288958 tttatgttaattgagagaatttccaatttgattacaggaactactataggtgttcagcggatggatgccaagtgaaaaagagagttgagagagatgtgga 48288859  T
231 cgatccaagttatgtaataaca 252  Q
    ||||||||||||||||||||||    
48288858 cgatccaagttatgtaataaca 48288837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 48289018 - 48288986
Alignment:
30 aacatctacatatgaatatgatatagtttaagt 62  Q
    |||||||||||||||||||||||||||||||||    
48289018 aacatctacatatgaatatgatatagtttaagt 48288986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University