View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14560_low_11 (Length: 252)
Name: NF14560_low_11
Description: NF14560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14560_low_11 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 131 - 252
Target Start/End: Complemental strand, 48288958 - 48288837
Alignment:
| Q |
131 |
tttatgttaattgagagaatttccaatttgattacaggaactactataggtgttcagcggatggatgccaagtgaaaaagagagttgagagagatgtgga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288958 |
tttatgttaattgagagaatttccaatttgattacaggaactactataggtgttcagcggatggatgccaagtgaaaaagagagttgagagagatgtgga |
48288859 |
T |
 |
| Q |
231 |
cgatccaagttatgtaataaca |
252 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48288858 |
cgatccaagttatgtaataaca |
48288837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 48289018 - 48288986
Alignment:
| Q |
30 |
aacatctacatatgaatatgatatagtttaagt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48289018 |
aacatctacatatgaatatgatatagtttaagt |
48288986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University