View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14560_low_16 (Length: 236)
Name: NF14560_low_16
Description: NF14560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14560_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 82 - 219
Target Start/End: Original strand, 8827252 - 8827389
Alignment:
| Q |
82 |
atcaaactgtcttagtttagatacttcacaaagtacttcaacttcaagcataagactgaagcggcttagtacattcatttttcaccaagcatctcatcct |
181 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8827252 |
atcaaattgtcttagtttagatacttcacaaagtacttcaacttcaagcataagactgaagcggcttagtacattcatttttcaccaagcatctcatcct |
8827351 |
T |
 |
| Q |
182 |
tggagtcatcacaaaattcttgtttggctggtacatcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8827352 |
tggagtcatcacaaaattcttgtttggctggtacatcc |
8827389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University