View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14560_low_17 (Length: 216)
Name: NF14560_low_17
Description: NF14560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14560_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 85 - 196
Target Start/End: Original strand, 36915752 - 36915863
Alignment:
| Q |
85 |
tagtttgtacattgtaggattatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat |
184 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36915752 |
tagtttgtacattgtaggtttatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat |
36915851 |
T |
 |
| Q |
185 |
ttctctgtttat |
196 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36915852 |
ttctctgtttat |
36915863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University