View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14560_low_17 (Length: 216)

Name: NF14560_low_17
Description: NF14560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14560_low_17
NF14560_low_17
[»] chr5 (1 HSPs)
chr5 (85-196)||(36915752-36915863)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 85 - 196
Target Start/End: Original strand, 36915752 - 36915863
Alignment:
85 tagtttgtacattgtaggattatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat 184  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36915752 tagtttgtacattgtaggtttatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat 36915851  T
185 ttctctgtttat 196  Q
    ||||||||||||    
36915852 ttctctgtttat 36915863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University