View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14562_high_10 (Length: 203)
Name: NF14562_high_10
Description: NF14562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14562_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 50439954 - 50439766
Alignment:
| Q |
1 |
tcggtatactcttttctcacggataaaaatcctcattgaga-----aatgattccaacttgtttaaactggtctaaaagtggaatgaacttgataggatc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50439954 |
tcggtatactcttttctcacggataaaaatcctcattgagagaaataatgattccaacttgtttaaactggtctaaaagtggaatgaacctgataggatc |
50439855 |
T |
 |
| Q |
96 |
cacttttttctttagaaagttttccatggtagattgatgagcaatgatcgatgagaaatataaattcaatttgactgctgaccacaacc |
184 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439854 |
catttttttctttagaaagttttccatggtagattgatgaccaatgatcgatgagaaatataaattcaatttgactgctgaccacaacc |
50439766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University