View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14562_high_6 (Length: 250)
Name: NF14562_high_6
Description: NF14562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14562_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 1458276 - 1458520
Alignment:
| Q |
1 |
taacacaactgaaaaccctatattcaagcctctatctttcaaattcattctcatccttcattgaacttttttcactcattctatgactctctacccttca |
100 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1458276 |
taacataacagaaaaccctatattcaagcctctatctttcaaattcattctcatccttcattgaactttt-tcactcattctatgactctctacccttca |
1458374 |
T |
 |
| Q |
101 |
atcccctctatttaaacaactctaataattcacattatttggtgtctcattgttcagctcgatctcccaccatgggtagcataaaccttgagcagatgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1458375 |
atcccctctatttaaacaactctaataattcacattatttggtgtctcattcttcagctcgatctcccaccatgggtagcatcaaccttgagcagatgaa |
1458474 |
T |
 |
| Q |
201 |
aaacgaggatgtcaatttggtataatacttctcttctcttcatctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1458475 |
aaacgaggatgtcaatttggtataatacttctcttctctccatctc |
1458520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 144 - 226
Target Start/End: Original strand, 26786521 - 26786603
Alignment:
| Q |
144 |
gtctcattgttcagctcgatctcccaccatgggtagcataaaccttgagcagatgaaaaacgaggatgtcaatttggtataat |
226 |
Q |
| |
|
|||||||| ||||||| ||||| || ||||| ||||| |||||||||||| | ||||||||| ||||| |||||||||||| |
|
|
| T |
26786521 |
gtctcatttttcagctaaatctctcagcatggccagcatcaaccttgagcagttaaaaaacgagaatgtcgatttggtataat |
26786603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University