View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14563_high_17 (Length: 209)
Name: NF14563_high_17
Description: NF14563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14563_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 37 - 192
Target Start/End: Original strand, 37307991 - 37308136
Alignment:
| Q |
37 |
tatcattctctaatcatgcatgttagcagggacggatctgtgtgaggctgggtgtggctgttgccgcaccagcacagcctatattttctaatatatgtgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | | |
|
|
| T |
37307991 |
tatcattctctaatcatgcatgttagcagggacggatctgtgtgaggctg----------ttgccacaccagcacagcctatattttctaatatatatct |
37308080 |
T |
 |
| Q |
137 |
tatatttcaatataagacaacatattaaatgttcgtctagtggcttggaggagttg |
192 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
37308081 |
tatatttcaatataagacaacgtattaaacgttcgtctagtggcttggaggagttg |
37308136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University