View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14564_high_7 (Length: 250)
Name: NF14564_high_7
Description: NF14564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14564_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 153
Target Start/End: Original strand, 7884751 - 7884892
Alignment:
| Q |
12 |
ataggggagagtgtaggtgaagttcgggctgtatcggacatgcaccaatgcaaggccgaaatggctcgacaagccgatgcttttattgccttgctaggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7884751 |
ataggggagagtgtaggtgaagttcgggctgtatcggacatgcaccaacgcaaggccgaaatggctcgacaggccgatgcttttattgccttgccaggtt |
7884850 |
T |
 |
| Q |
112 |
acttttttctcttcgtagctctaacatggtaactcaagaaaa |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7884851 |
acttttttctcttcgtagctctaacatggtaactcaagaaaa |
7884892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 150 - 250
Target Start/End: Original strand, 7885052 - 7885152
Alignment:
| Q |
150 |
aaaacgtacgttttatctcattgcagtttttataacaataattttcctattcttataggtggatatgacaccttggaagaactattagaagtgatcacct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885052 |
aaaacgtacgttttatctcattgcagtttttataacaataattttcctattcttataggtggatatgacaccttggaagaactattagaagtgatcacct |
7885151 |
T |
 |
| Q |
250 |
c |
250 |
Q |
| |
|
| |
|
|
| T |
7885152 |
c |
7885152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 103
Target Start/End: Original strand, 53033206 - 53033270
Alignment:
| Q |
39 |
gctgtatcggacatgcaccaatgcaaggccgaaatggctcgacaagccgatgcttttattgcctt |
103 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
53033206 |
gctgtatcggacatgcaccaacgcaaagccgaaatggctcgacaagctgatgcatttattgcctt |
53033270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University