View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14564_low_13 (Length: 267)
Name: NF14564_low_13
Description: NF14564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14564_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 31935902 - 31936153
Alignment:
| Q |
1 |
cgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaattctgctaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935902 |
cgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaattctgctaatgt |
31936001 |
T |
 |
| Q |
101 |
tgccggtggtgttgcaccgttaccgttgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcgaatttgcaaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936002 |
tgccggtggtgttgcaccgttaccattgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcgaatttgcaaccg |
31936101 |
T |
 |
| Q |
201 |
gttcttgcccagaatctacctgaccaaccggctggtgcttggaaggtttgtg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31936102 |
gttcttgcccagaatctacctgaccaaccggctagtgcttggaaggtttgtg |
31936153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 159 - 248
Target Start/End: Complemental strand, 8810344 - 8810255
Alignment:
| Q |
159 |
gttgagcaagttccgtgaccagaatcgtcgaatttgcaaccggttcttgcccagaatctacctgaccaaccggctggtgcttggaaggtt |
248 |
Q |
| |
|
||||||||||||||||| || || || ||||||| ||| ||||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
8810344 |
gttgagcaagttccgtggccggagtcatcgaattggcagccggttcttccccagaatctacctgaccatccggttggtgcttggaaggtt |
8810255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 27975632 - 27975686
Alignment:
| Q |
11 |
ttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatct |
65 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
27975632 |
ttcaactatcatcggaagattgtaaccgtcgacgagactcacgtcgtagaaatct |
27975686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University