View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14564_low_17 (Length: 227)
Name: NF14564_low_17
Description: NF14564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14564_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 6 - 181
Target Start/End: Original strand, 38418975 - 38419150
Alignment:
| Q |
6 |
atacagaacatgacagtcatccggactcaaactaaagaataaatataatatactttcatatattattaccacggttttagactgtttagttaagatcacc |
105 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38418975 |
atacagaacatgacagtcatcccgactcaaactaaagaataaatataatatactttcatatattattaccacggttttagagtgtttagttaagatcacc |
38419074 |
T |
|
| Q |
106 |
nnnnnnnttattgtttattagaagttcaccaaagaaaattcaactagcaatagtatagatgactggggttatttac |
181 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38419075 |
aaaaaaattattgcttattagaagttcaccaaagaaaattcaactagcaatagtatagatggctggggttatttac |
38419150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University