View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_high_34 (Length: 270)
Name: NF14565_high_34
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 25709633 - 25709393
Alignment:
| Q |
13 |
ataggtaaaaaggtttggtcacattttgaagaaagctgcagcaagaaaattgtctttacctaccagcaataaaataatatgatctctaaacatatattta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709633 |
ataggtaaaaaggtttggtcacattttgaagaaagctgcagcaagaaaattgtctttacctaccagcaataaaataatatgatctctaaacatatattta |
25709534 |
T |
|
| Q |
113 |
ataaagtctgcaaacaaaatttttctcgaccacgtctacactctaaaccctaaatatttcaatgtatctattagaaagtgcattatcatattagatactg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709533 |
ataaagtctgcaaacaaaatttttctcgaccacgtctacactctaaaccctaaatatttcaatgtatctattagaaagtgcattatcatattagatactg |
25709434 |
T |
|
| Q |
213 |
tagattctggataacgcctgtagattttgagagagacatgt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709433 |
tagattctggataacgcctgtagattttgagagagacatgt |
25709393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University