View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_high_38 (Length: 247)
Name: NF14565_high_38
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_high_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 14349970 - 14350211
Alignment:
| Q |
1 |
caatttgttcttcttttgcatattgatttaattttctgttgcaacttgtctttaaaagtattagtatttgttatctaatgataatgataatgattaatga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14349970 |
caatttcttcttcttttgcatattgatttaattttctgttgcaacttgtctttagaagtattagtatttgttatctaatgatgatgataatgattaatga |
14350069 |
T |
 |
| Q |
101 |
catctattcgtgctttagggaaggcactaccatagagggccactaaatgttatttgcttgtccacacctgaattgagaagatttaggaacgacgttgatg |
200 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||| ||||| |||||||||| ||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
14350070 |
catctatacttgctttagggaatgcactaccatagaggaccacttaatgttattttcttgtcctcacctgaattgagaagatttaggaactccgttgatg |
14350169 |
T |
 |
| Q |
201 |
actaaaattaaagggtcgatgttagaatctcgcatgaaacgaggata |
247 |
Q |
| |
|
|||| |||||| ||| ||||||||||| |||||||||| |||| |
|
|
| T |
14350170 |
acta-----aaaggggcgaagttagaatctcacatgaaacgatgata |
14350211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University