View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_high_46 (Length: 227)
Name: NF14565_high_46
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 21992063 - 21992194
Alignment:
| Q |
7 |
ttggcggccttatttatcttacttctctctatggaagctgccattgctcaaggccaaggaaat------------ggtaacaatggcaacggtaagggaa |
94 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21992063 |
ttggtggccttatttatcttacttatctctatggaagctgccattgctcaaggccaaggaaatggtaatggcaacggtaacaatggcaacggtaagggaa |
21992162 |
T |
 |
| Q |
95 |
atggtaatggtaacggtaacaatggcaatggt |
126 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
21992163 |
atggtaatggtaatggtaacaatggcaatggt |
21992194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 22009413 - 22009492
Alignment:
| Q |
7 |
ttggcggccttatttatcttacttctctctatggaagctgccattgctcaaggccaaggaaatggtaacaatggcaacggtaa |
89 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22009413 |
ttggtggccttatttatcttacttatctctatggaagctgccattgctcaaggccaaggaaatggt---aatggcaacggtaa |
22009492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 70 - 116
Target Start/End: Original strand, 22009518 - 22009564
Alignment:
| Q |
70 |
ggtaacaatggcaacggtaagggaaatggtaatggtaacggtaacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22009518 |
ggtaacaatggcaacggtaagggaaatggtaatggtaagggtaacaa |
22009564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University