View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_low_31 (Length: 328)
Name: NF14565_low_31
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 9086478 - 9086216
Alignment:
| Q |
15 |
atgaaaaatgctaaacttacctaagccttcatttgtagaaatcaaagatgcagttttttctttaaagcagaagagtgatatcggtctttatatatggatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9086478 |
atgaaaaatgctaaacttacctaagccttcatttgtagaaatcaaagatgcagttttttctttaaagcagaagagtgatattggtctttatatatggatt |
9086379 |
T |
 |
| Q |
115 |
tggtgccactttttcatcataattttgaagatattattggaaatgacgtgtataatgcaactaaggaaagcttggattcttcctaatcttaattctaatt |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9086378 |
tggtggcactttttcatcataattttgaagatattattggaaatgatgtgtataatgcaactaaggaaaggttggattcttcctaatcttaattctaatt |
9086279 |
T |
 |
| Q |
215 |
tagtagttttaattcctaaattttctggaaccattgccttggcaaacttccaatacaaaataa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086278 |
tagtagttttaattcctaaattttctggaaccattgccttggcaaacttccaatacaaaataa |
9086216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University