View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_low_34 (Length: 323)
Name: NF14565_low_34
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 27631745 - 27631438
Alignment:
| Q |
16 |
agggagagtgagcagagagggnnnnnnnngagcggaagtggtggtggtggtcatgatgacaacgggtgttttcccaggagatttgagggagaggtcgatg |
115 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631745 |
agggagagcgagcagagagggaaaaaaaagagtggaagtggtggtggtggtcatgatgacaacgggtgttttcccaggagatttgagggagaggtcgatg |
27631646 |
T |
 |
| Q |
116 |
gtgggtgtggccggtagtggtggttgggctaaaaagcctttttaaaatatgcaatctaaaaataatgctcgaacttggctctttatgggatacttttgta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631645 |
gtgggtgtggccggtagtggtggttgggctaaaatgcctttttaaaatatgcaatctaaaaataatgctcgaacttggctctttatgggatacttttgta |
27631546 |
T |
 |
| Q |
216 |
cccctcaactatcacaagtcttcgtctccaagccttaaggtaacgatttgggggcaactgacgtacaagaacaactacaatctacacaagaagtttaaac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631545 |
cccctcaactatcacaagtcttcgtctccaagccttaaggtaacgatttgggggcaactgacgtacaagaacaactacaatctacacaagaagtttaaac |
27631446 |
T |
 |
| Q |
316 |
acgacact |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
27631445 |
acgacact |
27631438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University