View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_low_42 (Length: 272)
Name: NF14565_low_42
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 52072037 - 52071800
Alignment:
| Q |
17 |
ggggagaagtccttgttgtgcaaaggagggattgaacagaggtgcttggacagctcatgaagacaaaattctctcagactacattaagctccatggtgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52072037 |
ggggagaagtccttgttgtgcaaaggagggattgaacagaggtgcttggacagctcatgaagacaaaattctctcagactacattaagctccatggtgaa |
52071938 |
T |
 |
| Q |
117 |
ggaaaatggagaaaccttcccaaaagagcaggttcattaattatgtatcttcttacatagatcatcaatgacacacttttgtttgcttatannnnnnncc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
52071937 |
ggaaaatggagaaaccttcccaaaagagcaggttcattaattatgtatcttcttacatagatcatcaatgacgcacttttgtttgcttatatttttttcc |
52071838 |
T |
 |
| Q |
217 |
ttcatgtttttgtaaatatatttatgccatgcaggttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52071837 |
ttcatgtttttgtaaatatatttatgccatgcaggttt |
52071800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University