View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_low_61 (Length: 213)
Name: NF14565_low_61
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 26527400 - 26527207
Alignment:
| Q |
1 |
ccaagaatatgtgtcataacaaaacttgagatcgtagactgaagccatgataacagccactgatcttgctgaatccatgta-gatacgcaggattttcag |
99 |
Q |
| |
|
||||||||| |||||| |||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
26527400 |
ccaagaatacgtgtcacaacagaacttaagatcgtagactggagccatgataacagccactgatcttgctgaatccatgtgcgatacacagggttttcat |
26527301 |
T |
|
| Q |
100 |
agaaagagttcgtgataaaatccttgatgaattcatcaggaatctccgcatggtacaaaaaactttgaagatggtgagcgtttaccacaggttc |
193 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26527300 |
agaaagagttcgtgatagaatccttgatgaattcatcaggaatctcagcatagtacaaaaaactttgaagattttgagcgtttaccactggttc |
26527207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University