View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14565_low_64 (Length: 204)
Name: NF14565_low_64
Description: NF14565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14565_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 31254491 - 31254655
Alignment:
| Q |
17 |
aacatatataacatgcatcacatgcttgcgacaacaatgtgatcttgttattaatacccttgccaaagtgctaaaaggtcttcgagagttctagtactcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31254491 |
aacatatataacatgcatcacatgcttgcgacaacaatgtgatcttgttattaatacccttgccaaagtgctaaaaggtcttcgagagttctagtactcc |
31254590 |
T |
 |
| Q |
117 |
tannnnnnnnnnnnnnnnncttatgaaatttagagtgctctttttgtttgcctttatcacaacaaagttcat |
188 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31254591 |
ta-------ttttttttttcttatgaaatttagagtgctctttttgtttgcctttatcacaacaaagttcat |
31254655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University