View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14566_low_2 (Length: 432)
Name: NF14566_low_2
Description: NF14566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14566_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 175 - 429
Target Start/End: Complemental strand, 40633063 - 40632809
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatataagcagaaaaactacaatcaattagctaaatcttaaacc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40633063 |
atcaaagctagaaaatttaaaatgcaaagcagaagtaggcctaaaccatattacaacatataagcagaaaaactacgatcaattagctaaatcttaaacc |
40632964 |
T |
 |
| Q |
275 |
aaagaaactagatactagcacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggata |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40632963 |
aaagaaactagatactagcacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggata |
40632864 |
T |
 |
| Q |
375 |
tgcctactacctgtgatgccatcagaacctttgccattgtgagtcatatgtctct |
429 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40632863 |
tgctcactacctgtgatgccatcagaacctttgccattgtgagtcatatgtctct |
40632809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 74 - 157
Target Start/End: Complemental strand, 40633457 - 40633374
Alignment:
| Q |
74 |
tatctttctttttcttgagggacggggatgatcataaattacacaaaggaaactttatatttaataatttatatataaaattaa |
157 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40633457 |
tatctttctttttttcgagggacggggatgatcataaattacacaaaggaaactttatatttaataatttatatataaaattaa |
40633374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 290 - 409
Target Start/End: Original strand, 16140344 - 16140463
Alignment:
| Q |
290 |
tagcacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtg |
389 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||||||| || |||||||||||||| |||||||| | |||||||||| ||| ||||| |||| |
|
|
| T |
16140344 |
tagcacatattaagaaacatctcctggaagtcaaacatatttagggttgcttttgattacatcctttttaagacgagtttggatttgctcactacttgtg |
16140443 |
T |
 |
| Q |
390 |
atgccatcagaacctttgcc |
409 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
16140444 |
atgccatcagagcctttgcc |
16140463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 318 - 416
Target Start/End: Original strand, 42080687 - 42080785
Alignment:
| Q |
318 |
agtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgccattgtga |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| ||| ||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
42080687 |
agtcaaacatatttgggattgcttttgattacaccctttttggaacgagtttggatgtgctcactacttgtgacgccatcagtggttttgccattgtga |
42080785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 290 - 409
Target Start/End: Complemental strand, 9058025 - 9057906
Alignment:
| Q |
290 |
tagcacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtg |
389 |
Q |
| |
|
||||||||||||||||||||| | | | ||||||||||||| |||||||||||||||| |||||||| | ||||||||| ||| ||||| ||| |
|
|
| T |
9058025 |
tagcacatattaagaaacatctccttgcaatcaaacatatttgagattgcttttgattacaccctttttgagacaagtttggatgtgctcactacttgta |
9057926 |
T |
 |
| Q |
390 |
atgccatcagaacctttgcc |
409 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
9057925 |
atgccatcagagcctttgcc |
9057906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 175 - 241
Target Start/End: Original strand, 42080493 - 42080559
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatataagcag |
241 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||| ||||||| |||| |||||||||| |||||||| |
|
|
| T |
42080493 |
atcaaagctagaaaaattaaaatccaaaggaggaataggcctcaaccttattacaacaaataagcag |
42080559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 40633857 - 40633911
Alignment:
| Q |
18 |
attgacatgatttaggaataagtggacatggatatttgtgggtggtatggatgag |
72 |
Q |
| |
|
||||||||||||| | ||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
40633857 |
attgacatgatttggaaataagtggacgtagatatttgcgggtggtatggatgag |
40633911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 370
Target Start/End: Original strand, 43403898 - 43403942
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
43403898 |
atatttgggattgcttttgatgacaccctttttagaacgagtttg |
43403942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 322 - 406
Target Start/End: Complemental strand, 18187988 - 18187904
Alignment:
| Q |
322 |
aaacatatttgggattgcttttgattacgccctttttagaat-gagtttggatatgcctactacctgtgatgccatcagaaccttt |
406 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| ||| |||| |||||||||| ||| ||||| |||||||||| | |||||||| |
|
|
| T |
18187988 |
aaacatatttgggattgctttaaattacaccctcttt-gaatcgagtttggatgtgctcactacttgtgatgccaccggaaccttt |
18187904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 40646370 - 40646325
Alignment:
| Q |
18 |
attgacatgatttaggaataagtggacatggatatttgtgggtggt |
63 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
40646370 |
attgacatgatttgggaataagtggacggagatatttgtgggtggt |
40646325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 1e-20; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 322 - 409
Target Start/End: Original strand, 10501971 - 10502058
Alignment:
| Q |
322 |
aaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgcc |
409 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||| |||||||||| ||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
10501971 |
aaacatatttgggattgctttttattacaccctttttggaacgagtttggatgtgcttactacttgtgatgccatcagagtctttgcc |
10502058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 320 - 406
Target Start/End: Complemental strand, 31934795 - 31934709
Alignment:
| Q |
320 |
tcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaaccttt |
406 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||||||||||| |||||||||| | | ||||| |||||||||| |||||||||| |
|
|
| T |
31934795 |
tcaaacatatttgagattgcttttaattacaccctttttagatcgagtttggatgttctcactacttgtgatgccaccagaaccttt |
31934709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 175 - 236
Target Start/End: Original strand, 28101457 - 28101518
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatata |
236 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
28101457 |
atcaaagcaagaaaaattaaaatgcaaagcaggaggaggcctgaaccttattacaacatata |
28101518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 175 - 242
Target Start/End: Original strand, 10501787 - 10501854
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatataagcaga |
242 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||| |||| | || |||||||||||||||||||||| |
|
|
| T |
10501787 |
atcaaagctagaaaaattaaattgcaaaacaggagaaggcatgaaacatattacaacatataagcaga |
10501854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 32655622 - 32655557
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatataagcag |
241 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||||||| ||| |||| |||||||||||| |||||| |
|
|
| T |
32655622 |
atcaaagttagaaaatt-aaattgcaaagcaggagtagacctgaaccttattacaacataaaagcag |
32655557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 280 - 409
Target Start/End: Complemental strand, 4922885 - 4922756
Alignment:
| Q |
280 |
aactagatactagcacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcct |
379 |
Q |
| |
|
|||||| | |||||||||||||||||||||| | | | |||||||||||||||||| ||||||| || | |||||||| ||| ||||||| || ||| |
|
|
| T |
4922885 |
aactagctcctagcacatattaagaaacatctcctgacagtcaaacatatttgggaatgctttttatgagaccctttttggaacgagtttgaatgtgctc |
4922786 |
T |
 |
| Q |
380 |
actacctgtgatgccatcagaacctttgcc |
409 |
Q |
| |
|
||||| | ||||||||||||| |||||||| |
|
|
| T |
4922785 |
actacttatgatgccatcagagcctttgcc |
4922756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 282 - 373
Target Start/End: Complemental strand, 6596627 - 6596535
Alignment:
| Q |
282 |
ctagatactagcacatattaagaaacatcg-cataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggat |
373 |
Q |
| |
|
|||| ||| ||||| ||||||||| |||| ||||| | ||| | |||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6596627 |
ctagctaccagcacttattaagaaccatctacataacaatcacaaatatttaggattgcttttgattacaccctttttagaatgagtttggat |
6596535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 370
Target Start/End: Complemental strand, 26155341 - 26155297
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
26155341 |
atatttgggattgcttttgatgacgcactttttagaacgagtttg |
26155297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 7e-16; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 293 - 409
Target Start/End: Original strand, 24977794 - 24977905
Alignment:
| Q |
293 |
cacatattaagaaacatcgcataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatg |
392 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| ||||||| | ||||||||||||||| | |||||| ||| |||||||||| || |||| ||||||| |
|
|
| T |
24977794 |
cacatattaagaaacatctcatgacagtcaaccatattt-gaattgcttttgattacactctttttggaacgagtttggatgtg----ctacttgtgatg |
24977888 |
T |
 |
| Q |
393 |
ccatcagaacctttgcc |
409 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
24977889 |
ccatcagagcctttgcc |
24977905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 175 - 241
Target Start/End: Original strand, 12066994 - 12067060
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatataagcag |
241 |
Q |
| |
|
||||||||||||||| ||||| | |||||||| ||||||| | |||| ||||||||||||||||||| |
|
|
| T |
12066994 |
atcaaagctagaaaaattaaattacaaagcagaagtaggcatgaaccttattacaacatataagcag |
12067060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 400
Target Start/End: Original strand, 16595094 - 16595172
Alignment:
| Q |
322 |
aaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcaga |
400 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||| || |||||||||| | | ||||| ||||||||||||||| |
|
|
| T |
16595094 |
aaacatatttgggattgctttttataacaccctttttgaaacgagtttggatgtactcactacttgtgatgccatcaga |
16595172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 370
Target Start/End: Original strand, 3958949 - 3958993
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
3958949 |
atatttgggattgcttttgatgacaccctttttagaacgagtttg |
3958993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 326 - 377
Target Start/End: Complemental strand, 2049050 - 2048999
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttggatatgc |
377 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||| ||||||| |||||| |
|
|
| T |
2049050 |
atatttgggattgcttttgataacaccctttttggaacgagtttgtatatgc |
2048999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 370
Target Start/End: Original strand, 1558385 - 1558429
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||| ||||||| |
|
|
| T |
1558385 |
atatttgggattggttttgatgacaccctttttagaacgagtttg |
1558429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 175 - 232
Target Start/End: Complemental strand, 18519445 - 18519388
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaaca |
232 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
18519445 |
atcaaagctagaaaaattaaaatgctaggcaggagtaggcctgaaccatattacaaca |
18519388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 3248213 - 3248267
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattaca |
229 |
Q |
| |
|
|||||||| |||||| ||||||||||||| ||||| |||||| |||| ||||||| |
|
|
| T |
3248213 |
atcaaagcaagaaaaattaaaatgcaaagtaggaggaggcctgaaccttattaca |
3248267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 370
Target Start/End: Complemental strand, 18979926 - 18979882
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||| ||||||| |
|
|
| T |
18979926 |
atatttgggattggttttgatgacaccctttttagaacgagtttg |
18979882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 362
Target Start/End: Complemental strand, 31610101 - 31610065
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaa |
362 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
31610101 |
atatttgggattgcttttgatcacaccctttttagaa |
31610065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 320 - 412
Target Start/End: Original strand, 25862607 - 25862699
Alignment:
| Q |
320 |
tcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgccatt |
412 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| |||||||| || |||||||||| ||| ||||| |||||||||| | |||||||| ||||| |
|
|
| T |
25862607 |
tcaaacatatttaggattgcttttaattacaccctttttggatcgagtttggatgtgctcactacttgtgatgccaccggaaccttttccatt |
25862699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 315 - 412
Target Start/End: Complemental strand, 4277397 - 4277300
Alignment:
| Q |
315 |
aatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgccatt |
412 |
Q |
| |
|
|||| |||||||||||||||||||||||| || || |||||||| || ||| ||||||| ||| ||||| |||||||||| || |||| || ||||| |
|
|
| T |
4277397 |
aatactcaaacatatttgggattgcttttaatgacaccctttttggattgattttggatgtgctcactacttgtgatgccaccacaaccgtttccatt |
4277300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 325 - 409
Target Start/End: Complemental strand, 32033860 - 32033776
Alignment:
| Q |
325 |
catatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgcc |
409 |
Q |
| |
|
||||||| |||||| ||| || || |||||||| ||| |||||||||||||| ||||| |||||||||||| || |||||||| |
|
|
| T |
32033860 |
catatttaggattgtgttttataacaccctttttggaacgagtttggatatgctcactacttgtgatgccatccgagcctttgcc |
32033776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 175 - 236
Target Start/End: Original strand, 35553943 - 35554004
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggcctaaaccatattacaacatata |
236 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||| |||||| |||| |||||||||||||| |
|
|
| T |
35553943 |
atcaaagcaagaaaaattaaaatgcaaatcaggaggaggcctgaaccttattacaacatata |
35554004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 326 - 370
Target Start/End: Original strand, 21949901 - 21949945
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
21949901 |
atatttgggattgcttttgattacaccctttttagaacgagtttg |
21949945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 325 - 409
Target Start/End: Original strand, 30426132 - 30426216
Alignment:
| Q |
325 |
catatttgggattgcttttgattacgccctttttagaatgagtttggatatgcctactacctgtgatgccatcagaacctttgcc |
409 |
Q |
| |
|
||||||| |||||| |||| ||||| |||||||| ||| |||||||||| ||| ||||| |||||||||||| || |||||||| |
|
|
| T |
30426132 |
catattttggattgttttttattacaccctttttggaacgagtttggatgtgctcactacttgtgatgccatccgagcctttgcc |
30426216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 371
Target Start/End: Original strand, 41411479 - 41411571
Alignment:
| Q |
280 |
aactagatactagcacatattaagaaacatcg-cataatagtcaaacatatttgggattgcttttgattacgccctttttagaatgagtttgg |
371 |
Q |
| |
|
|||||| ||||||||| | ||||||| |||| ||| | ||||| | |||||||||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
41411479 |
aactagctactagcactttttaagaaccatctacatgacagtcacaaatatttgggattgcttttgattacaccctttttggaacgagtttgg |
41411571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 18559717 - 18559759
Alignment:
| Q |
328 |
atttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18559717 |
atttgagattgcttttgattacgccctttttagaacgagtttg |
18559759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 370
Target Start/End: Complemental strand, 40275201 - 40275157
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttg |
370 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
40275201 |
atatttgggattgcttttgatgacaccctttttagaacgagtttg |
40275157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Complemental strand, 14555952 - 14555902
Alignment:
| Q |
326 |
atatttgggattgcttttgattacgccctttttagaatgagtttggatatg |
376 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||| ||||||| ||||| |
|
|
| T |
14555952 |
atatttgggattgcttttgatcacaccctttttggaacgagtttgtatatg |
14555902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 1511179 - 1511218
Alignment:
| Q |
175 |
atcaaagctagaaaatttaaaatgcaaagcaggagtaggc |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1511179 |
atcaaagctagaaaaattaaaatgcaaagcaggagtaggc |
1511218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University