View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14566_low_3 (Length: 253)
Name: NF14566_low_3
Description: NF14566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14566_low_3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 4480467 - 4480225
Alignment:
| Q |
16 |
aatatatgtaaagcattatgctactataactattcataaaattagggtatttatggattgacctaggaaatccggtgatttaatttatttgattaaggat |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4480467 |
aatatatgtaaagcattatgctgctataactattcataaaattagggtattcatggattgacctaggaaatctggtgatttaatttatttgattaaggat |
4480368 |
T |
 |
| Q |
116 |
atttttggtatccacaactaattagtttttctt-----nnnnnnnnnnnnnnnnttagtttcttgcaaattactaatatttatgaatagcacttgttctg |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4480367 |
atatttggtatccacaactaattagtttttcttcaaaaagaaaaaaaaaacaaattagtttcttgcaaattactaatatttatgaatagcacttgttctg |
4480268 |
T |
 |
| Q |
211 |
aaccggttaaagatttgggcttaaaccacttagacccaacaac |
253 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||| |||||||| |
|
|
| T |
4480267 |
aaccggttaaagatctgagcttaaatcacttaggtccaacaac |
4480225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University