View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14566_low_4 (Length: 236)
Name: NF14566_low_4
Description: NF14566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14566_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 44033878 - 44033643
Alignment:
| Q |
1 |
tcaagggattccaaaattgtcttttctagaaccaatgaccaataactcatgtttgagtaaatgtatccaacccaagttcttggcaatgttaggcagcagc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44033878 |
tcaatggattccaaaattgtcttttctagaaccaatgaccaataactcatgtttgagtaaatgtatccaacccaagttcttggcaatgttaggcagcagc |
44033779 |
T |
 |
| Q |
101 |
ttgcagccaccctcatttgcagttagttaccttggaatattaattagtacattcaattacaatgagcattgtcaaaattattccaaggttaggctaaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44033778 |
ttgcagccaccctcatttgcagttagttaccttggaatattaattagtacattcaattacaatgagcattgtcaaaattattccaagattaggctaaatc |
44033679 |
T |
 |
| Q |
201 |
atctcaaacatttttcttgtggatggaattcaattc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44033678 |
atctcaaacatttttcttgtggatggaattcaattc |
44033643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University