View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_high_10 (Length: 229)
Name: NF14568_high_10
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 49 - 214
Target Start/End: Complemental strand, 8372434 - 8372270
Alignment:
| Q |
49 |
ttctttctaataacccaaactattccatcgaagttgagagcagcagacttcaatatttagggtatacactgtgtcactcacaccctccttatcaagtgtg |
148 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8372434 |
ttctttctaataacccaaactagtccatcgaagttgagagtagcagacttcaatatttagggtatacact-tgtcactcacaccctccttatcaagtgtg |
8372336 |
T |
|
| Q |
149 |
tggtagacagacatggccacaatgttatttattgctggtatgtactttacaaatctttcaactcta |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8372335 |
tggtagacattcatggccacaatgttatttattgctggtatgtactttacaaatctttcaactcta |
8372270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 8372630 - 8372593
Alignment:
| Q |
21 |
ttcgacgttgggcttcgtggctccatttttctttctaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8372630 |
ttcgacgttgggcttcgtggctccatttttctttctaa |
8372593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University