View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_high_4 (Length: 405)
Name: NF14568_high_4
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 9 - 387
Target Start/End: Complemental strand, 14817572 - 14817194
Alignment:
| Q |
9 |
cgaagaatataatatttttgcatacaacattaatttgttttgtttgggtgggatgcagagagtcattgataaggaagcagctgggatttcataattccaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817572 |
cgaagaatataatatttttgcatacaacattaatttgttttgtttgggtggtatgcagagagtcattgataaggaagcagctgggatttcataattccaa |
14817473 |
T |
|
| Q |
109 |
tgaggagatttgagtagtcgttggtggttacatctggaatttnnnnnnntaaaatcagtttgtattatggaatgctataaatcctttttagaccataaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817472 |
tgaggagatttgagtagtcgttggtggttacatctggaatttaaaaaactaaaatcagtttgtattatggaatgctataaatcctttttagaccataaag |
14817373 |
T |
|
| Q |
209 |
taaccaagtcctcgccttcccctgcactgtgttgtgtggagccagtgactcaagatgaacaaaattctcatattacagcttttcattcaggagatcgatc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817372 |
taaccaagtcctcgccttcccctgcactgtgttgtgtggagccagtgactcaagatgaacaaaattctcatattacagcttttcattcaggagatcgatc |
14817273 |
T |
|
| Q |
309 |
cacaaattcagataatgaatcttcttcatcaaagaccgtgcgtgatgtacatatcgtaagaatcactattgcacatctg |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817272 |
cacaaattcagataatgaatcttcttcatcaaagaccgtgcgtgatgtacatatcgtaagaatcactattgcacatctg |
14817194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University