View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_high_5 (Length: 391)
Name: NF14568_high_5
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 251 - 365
Target Start/End: Complemental strand, 29542549 - 29542435
Alignment:
| Q |
251 |
atatatattttgatgtaagaatatgnnnnnnnatgataatatgcttttgcattttgataatcactttgcaaaaggatataattcattatggaaacaactt |
350 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29542549 |
atatatattttgatgtaagaatatgttcttttatgataatatgcttttgcattttgataatcactttgcaaaaggatataattcattatggaaacaactt |
29542450 |
T |
 |
| Q |
351 |
aggtatgaatataga |
365 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29542449 |
aggtatgaatataga |
29542435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 2 - 188
Target Start/End: Complemental strand, 29542815 - 29542624
Alignment:
| Q |
2 |
agggaagtgagtatgtaaaaattccttgttttcatagagat-gttttattt---atttattttagccattcatagagatgcttaaaaattgagagattta |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| || ||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29542815 |
agggaagtaagtatgtaaaaattccttgttttcatagaaattgttttttttttaatttattttagccattcatagagatggttaaaaattgagagattta |
29542716 |
T |
 |
| Q |
98 |
ttaacagcgtaagtt-gtttcaaataaaatataagagacaaaattacaaactttaattttataatttttagcaaacacaacattctttaatt |
188 |
Q |
| |
|
|||||||||||| || ||| | | | | || | |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29542715 |
ttaacagcgtaatttctttttataaacattagttgttacaaaattacaaactttaattttataatttttagcaaacacaccattctttaatt |
29542624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University