View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_high_7 (Length: 266)
Name: NF14568_high_7
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 47473967 - 47473739
Alignment:
| Q |
18 |
ttatactactatcacaattttacaaagcttcttcgttacaaaggtgtgtatatacaggttgaagcttttggggtgggtgctgctttaagccattaactat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47473967 |
ttatactactatcacaattttacaaagctgcttcgttacaaaggtgt--atatacaggttgaagcttttggggtgggtgctgctttaagccattaactat |
47473870 |
T |
 |
| Q |
118 |
gtatcactgttagattgttggagaacattggtgagcacaaaggatatctggtagggtttatgttgatatttatgaggcacgtacagtggcattgctagat |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47473869 |
gtatcactgttagattgttggagtacattggggagcacaaaggatatctggtagggtttatgttgatatttatgaggcacgtacagtggcattgctagat |
47473770 |
T |
 |
| Q |
218 |
cttggttgccgtagaagctctattagtgtct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47473769 |
cttggttgccgtagaagctctattagtgtct |
47473739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University