View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_low_10 (Length: 266)
Name: NF14568_low_10
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 35 - 247
Target Start/End: Complemental strand, 41705837 - 41705625
Alignment:
| Q |
35 |
cataggcgaacgttgggattggctcttcaattaccgatagtgcaacaattacaatggtttagttttcaagcattttgtatattttaataagtaatttatc |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705837 |
cataggcgaacgttgggattggctattcaattaccgatagtgcaacaattacaatggtctagttttcaagcattttgtatattttaataagtaatttatc |
41705738 |
T |
|
| Q |
135 |
cactatgatatgctctttatatatatgtgctacttgacttaaatgaaaggaagaaaaactctgcaaagtttagcaagttccaaagtcgtttctctttgca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705737 |
cactatgatatgctctttatatatatgtgctacttgacttaaatgaaaggaagaaaaactctgcaaagtttagcaagttccaaagtcgtttctctttgca |
41705638 |
T |
|
| Q |
235 |
tcttacaaaagag |
247 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41705637 |
tcttacaaaagag |
41705625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University