View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14568_low_12 (Length: 256)
Name: NF14568_low_12
Description: NF14568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14568_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 41741590 - 41741409
Alignment:
| Q |
60 |
gcagattgtacatctaatgcaattaaaatttatcataatgaaataagtaatatgtaacatcctagataactttaagtatttgtgagtatcctatcaaaat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41741590 |
gcagattgtacatctaatgcaattaaaatttatcataatgaaataagtaatatgtaacatcctagataactttaagtatttgtgagtatcctatcaaaat |
41741491 |
T |
 |
| Q |
160 |
atcacgagacttttcttaatgttttattctcactcacaaacattctatgaaacttctgagcatgtcattaatatcaaaattt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41741490 |
atcacgagacttttcttaatgttttattctcactcacaaacattctatgaaacttctgaacatgtcattaatatcaaaattt |
41741409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 92 - 139
Target Start/End: Original strand, 21719236 - 21719283
Alignment:
| Q |
92 |
tcataatgaaataagtaatatgtaacatcctagataactttaagtatt |
139 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
21719236 |
tcataattgaataagtaatatgtaacatcctaaacaactttaagtatt |
21719283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 92 - 139
Target Start/End: Original strand, 21727072 - 21727119
Alignment:
| Q |
92 |
tcataatgaaataagtaatatgtaacatcctagataactttaagtatt |
139 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
21727072 |
tcataattgaataagtaatatgtaacatcctaaacaactttaagtatt |
21727119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 21729573 - 21729623
Alignment:
| Q |
89 |
ttatcataatgaaataagtaatatgtaacatcctagataactttaagtatt |
139 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| | ||||||||||||| |
|
|
| T |
21729573 |
ttatcataattgaataagcaatatgtaacatcctaaaaaactttaagtatt |
21729623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 139
Target Start/End: Original strand, 21848648 - 21848686
Alignment:
| Q |
101 |
aataagtaatatgtaacatcctagataactttaagtatt |
139 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
21848648 |
aataagtaatatgtaacatcctaaacaactttaagtatt |
21848686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University