View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14569_high_5 (Length: 291)
Name: NF14569_high_5
Description: NF14569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14569_high_5 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 157 - 291
Target Start/End: Complemental strand, 37454521 - 37454387
Alignment:
| Q |
157 |
ttgcaacatctattagatctttctcctctctttccatgtaggaatactgaattagttattattgcagcagcatccaattatttttactttaacatttcct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37454521 |
ttgcaacatctattagatctttctcctctctttccatgttggaatactgaattagttattattgcagcagcatccaattatttttactttaacatttcct |
37454422 |
T |
|
| Q |
257 |
ctcacctttcaaagttattccctactttactcttc |
291 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37454421 |
ctcacctttcaaagttattccctgctttactcttc |
37454387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 37454570 - 37454517
Alignment:
| Q |
169 |
ttagatctttctcctctctttccatgtaggaatactgaattagttattattgca |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
37454570 |
ttagatctttctcctctctttccatgttggaatattgaattagtcattattgca |
37454517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University