View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14569_low_11 (Length: 229)
Name: NF14569_low_11
Description: NF14569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14569_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 211
Target Start/End: Original strand, 7653938 - 7654133
Alignment:
| Q |
16 |
aatatctcgaataggattacttcttgtgcaagaaacatattagaaaccnnnnnnnnnnnnnnnnnnccatcttgtgcaagaaacccacttgaaggatact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
7653938 |
aatatctcgaataggattacttcttgtgcaagaaacatattagaaaccaaaaagtaaaaaagaaaaccatcttgtgcaagaaacccacttgaaggatatt |
7654037 |
T |
 |
| Q |
116 |
attgatacattgatgattaatatgaaagtatatgtggctagcaatcatgatttacttttctaacactcgtatacaaaatgtctccttactcatgtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7654038 |
attgatacattgatgattaatatgaaagtatatgtgattagcaatcatgatttacttttctaacactcgtatacaaaatgtctccttactcatgtc |
7654133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University