View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14569_low_5 (Length: 291)

Name: NF14569_low_5
Description: NF14569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14569_low_5
NF14569_low_5
[»] chr3 (2 HSPs)
chr3 (157-291)||(37454387-37454521)
chr3 (169-222)||(37454517-37454570)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 157 - 291
Target Start/End: Complemental strand, 37454521 - 37454387
Alignment:
157 ttgcaacatctattagatctttctcctctctttccatgtaggaatactgaattagttattattgcagcagcatccaattatttttactttaacatttcct 256  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37454521 ttgcaacatctattagatctttctcctctctttccatgttggaatactgaattagttattattgcagcagcatccaattatttttactttaacatttcct 37454422  T
257 ctcacctttcaaagttattccctactttactcttc 291  Q
    ||||||||||||||||||||||| |||||||||||    
37454421 ctcacctttcaaagttattccctgctttactcttc 37454387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 37454570 - 37454517
Alignment:
169 ttagatctttctcctctctttccatgtaggaatactgaattagttattattgca 222  Q
    ||||||||||||||||||||||||||| |||||| ||||||||| |||||||||    
37454570 ttagatctttctcctctctttccatgttggaatattgaattagtcattattgca 37454517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University