View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14569_low_8 (Length: 260)
Name: NF14569_low_8
Description: NF14569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14569_low_8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 7654580 - 7654336
Alignment:
| Q |
17 |
aaagagaagatcagattcttatttatgtgtttcttgattatatttcttttctgtataatttggttgaaattaaggggaaactataagagctttgtttagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7654580 |
aaagagaagatcagattcttatttatgtgtttcttgattatatttctttt---tataatttggttgaaattaaggggacactataagagctttgtttagt |
7654484 |
T |
|
| Q |
117 |
gtttaaataccaaaataaacggccaaggaaacggtcactgtgtgagactgtataggtttcaattatatgt----gccatgcatgcagctagtgaagtgag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
7654483 |
gtttaaataccaaaataaacggccaaggaaacggtcactgtgtgagactgtataggtttcaattatatgtgcaagctatgcatgcagctagtgaagtgag |
7654384 |
T |
|
| Q |
213 |
tgagctacttggtcatagttttgacatgtatgtggctgtgaattgatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7654383 |
tgagctacttggtcatagttttgacatgtatgtggctgtgaattgatg |
7654336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University