View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_high_17 (Length: 238)
Name: NF1456_high_17
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_high_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 33161113 - 33161332
Alignment:
| Q |
19 |
gatgtatctttgaagaggtaccggagctcgacatctctctccttcgtctttgtgtgcatttccttgatttgcaactctttttccttcaacttgttacttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33161113 |
gatgtatctttgaagaggtaccggagctcgacatctctctccttcatctttgtgtgcatttccttcatttgcaactctttttccttcaacttgttacttt |
33161212 |
T |
 |
| Q |
119 |
cttgcactctacatcccaatttttctaaagccgaagcttttaactttgccgcatcttccatcacagttagatcaacaatagccgaatgtgtttcgtttac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161213 |
cttgcactctacatcccaatttttctaaagccgaagcttttaactttgccgcatcttccatcatagttagatcaacaatagccgaatgtgtttcgtttac |
33161312 |
T |
 |
| Q |
219 |
ttttgattttccctttcttt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33161313 |
ttttgattttccctttcttt |
33161332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University