View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_high_19 (Length: 237)
Name: NF1456_high_19
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 37185534 - 37185316
Alignment:
| Q |
1 |
cggaagtccatgtactttcaataattcataaccacagctaattcctaaggaatactgctgagtgttgacacatcctgcaaattaaaaattgatgtgagcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37185534 |
cggaagtccatgtactttcaataattcataaccacagctaattcctaaggaatactgctgagtgttgacacatcctgcaaattaaaaattgatgtgagcg |
37185435 |
T |
 |
| Q |
101 |
ccttatcacgctctcatacatgcacaatattgatttctttactgcataagtttttcaggttaattggcagatgcaacttagaatatgcagaggttaattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37185434 |
ccttatcacgctctcatacatgcacaatattgatttctttactgcataagtttttccggttaattggcagatgcaacttagaatatgcagaggttaattg |
37185335 |
T |
 |
| Q |
201 |
gccttcacaaccatttccc |
219 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
37185334 |
gccctcacaaccatttccc |
37185316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University