View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_high_8 (Length: 285)
Name: NF1456_high_8
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 19798053 - 19797948
Alignment:
| Q |
1 |
tcattctttcttgtgctattctatgatgaaaaagcatattaatttatgcacactagaggtttgctctgcccccttaaaagattgatcttgtaacatacca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19798053 |
tcattctttcttgtgctgttctatgatgaaaaaacatattaatttatgcacactagaggtttgctctgcccccttaaaagattgatcttgtaacatacca |
19797954 |
T |
|
| Q |
101 |
acatgt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
19797953 |
acatgt |
19797948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 172 - 267
Target Start/End: Complemental strand, 19797874 - 19797779
Alignment:
| Q |
172 |
cgaaccaactaactccctaacagacttaactaacaacattcctaatgtcaatttccagttttcgtgcatgaagtagcttggaaaaaggtacctctt |
267 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
19797874 |
cgaatcaactaactccccaacagacttaactaagaacattcctaatgtcaatttccagttttcctacatgcagtagcttggaaaaaggtacctctt |
19797779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18319548 - 18319606
Alignment:
| Q |
1 |
tcattctttcttgtgctattctatgatgaaaaagcatattaatttatgcacactagagg |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18319548 |
tcattctttcttgtgcggttctatgatgaaaaaacatattaatttatgcacactagagg |
18319606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 53 - 104
Target Start/End: Original strand, 18320365 - 18320416
Alignment:
| Q |
53 |
ctagaggtttgctctgcccccttaaaagattgatcttgtaacataccaacat |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18320365 |
ctagaggtttgttctgcccccttaaaagaatgatcttgtaacataccaacat |
18320416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University