View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_13 (Length: 280)
Name: NF1456_low_13
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 51120464 - 51120727
Alignment:
| Q |
1 |
ttctctctcactatacgtgctccaaagcacttttgtttccttcgtcgtctcttccatagattctccaaccttaactccctcaacctttcgatatacttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51120464 |
ttctctctcactatacgtgctccaaagcacttttgtttccttcgtcgtctcttccatagattctccaaccttaattccctcaacctttcgatatact--- |
51120560 |
T |
 |
| Q |
101 |
tacggtaatgatatcaacttacttctcatccaaatatctcttttcccattgaaacttcgatcactccatctctccaacacacccaccaatcttgccaatg |
200 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51120561 |
-atggtaatgatatcaacttacttttcatccaaatatctcttttcccattgaaacttcgatcactccatctctccaacacacccaccaatcttgccaatg |
51120659 |
T |
 |
| Q |
201 |
gattgcgcgctttctctcaaaatgttacaactttgacttcactcacttttttcaacgtaaattatatt |
268 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51120660 |
gattgcgagctttctctcaaaatgttacaactttgacttcactcacttttttcaacgtaaattatatt |
51120727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 8186322 - 8186408
Alignment:
| Q |
160 |
atcactccatctctccaacacacccaccaatcttgccaatggattgcgcgctttctctcaaaatgttacaactttgacttcactcac |
246 |
Q |
| |
|
||||||| ||||||| |||| |||||||| || ||| ||||||||||| | | |||| | |||| ||||||||||||| |||||||| |
|
|
| T |
8186322 |
atcactcaatctctctaacaaacccaccattcctgcaaatggattgcgagttctctcccgaaatattacaactttgacctcactcac |
8186408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University