View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_17 (Length: 250)
Name: NF1456_low_17
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 45059757 - 45059516
Alignment:
| Q |
9 |
gattattctcaaaagtccttctaccaatatcaaaatttgacacaacagaacatgtttcagcattcatatcagtagttagatcagtttcctgtgacacact |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059757 |
gattattctcaaaagtccttctaccaatatccaaatttgacacaacagaacatgtttcagcattcatatcagtagttagatcagtttcctgtgacacact |
45059658 |
T |
|
| Q |
109 |
cataatttgttgctgtctctcagtcttgaaaccattgttttcatacaaagctcttaaaattgcttgatcttgcataccacaaacagaacttggatattgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059657 |
cataatttgttgctgtctctcagtcttgaaaccattgttttcatacaaagctcttaaaattgcttgatcttgcataccacaaacagaacttggatattgc |
45059558 |
T |
|
| Q |
209 |
aaattaaccgcagcttgattattagagtataatgaaccatta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45059557 |
aaattaaccgcagcttgattattagagtataatgaaccatta |
45059516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 153
Target Start/End: Complemental strand, 35363283 - 35363242
Alignment:
| Q |
112 |
aatttgttgctgtctctcagtcttgaaaccattgttttcata |
153 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
35363283 |
aatttgttgttatctctcagttttgaaaccattgttttcata |
35363242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University