View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_25 (Length: 237)
Name: NF1456_low_25
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_25 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 1433233 - 1433012
Alignment:
| Q |
17 |
aaaaggtaacatttattgtctttcttatgttgtttctgttattatgattatgtttcagttcatg-nnnnnnnnagttcagtttcatttgtttcatgttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1433233 |
aaaaggtaacatttattgtctttcttatgttgtttctgttattatgattatgtttcagttcatgtttttttttagttcagtttcatttgtttcatgttct |
1433134 |
T |
|
| Q |
116 |
ttatgagtttatgtcttcattgattttcttgtgttcacattgnnnnnnnnnnnnnnnnnnnnnnnnnaatgagtttgatcatggttttaaattgcggtcc |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1433133 |
ttatgaatttatgtcttcattgattttcttgtgttcacattgttttttttctttcttttctgttttcaatgagtttgatcatggttttaaattgcggtcc |
1433034 |
T |
|
| Q |
216 |
gcaatataaatgattttgatgt |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1433033 |
gcaatataaatgattttgatgt |
1433012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University