View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1456_low_26 (Length: 236)

Name: NF1456_low_26
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1456_low_26
NF1456_low_26
[»] chr2 (1 HSPs)
chr2 (16-219)||(8270192-8270395)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 8270192 - 8270395
Alignment:
16 atgaaggtagttaaaacgggtaggtagacactagacaagcttaaatcagggacataaaattggaagttcaaagtattggtgagggtgaggacgtgtatgt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8270192 atgaaggtagttaaaacgggtaggtagacactagacaagcttaaatcagggacataaaattggaagttcaaagtattggtgagggtgaggacgtgtatgt 8270291  T
116 gttgtgtgataagaggaattgtgtgactatgatatgagatgtcatcactcatcaatgtgaggagtaaattgtttatggaccaatgaacttcttgtcctat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8270292 gttgtgtgataagaggaattgtgtgactatgatatgagatgtcatcactcatcaatgtgaggagtaaattgtttatggaccaatgaacttcttgtcctat 8270391  T
216 tact 219  Q
    ||||    
8270392 tact 8270395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University