View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_28 (Length: 233)
Name: NF1456_low_28
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_28 |
 |  |
|
| [»] scaffold0193 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0193 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0193
Description:
Target: scaffold0193; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 23735 - 23862
Alignment:
| Q |
14 |
agaagatatgaatatagtgaacaatggatcgtagtttaaagaatactagagatactctaaacctagtacaatctaatatttatttttgaaaaagggatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23735 |
agaagatatgaatatagtgaacaatggatcatagtttaaagaaaactagagatactataaacctagtacaatctaatatttatttttgaaaaagggatca |
23834 |
T |
 |
| Q |
114 |
cattagtttattatatttttaaattgtt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
23835 |
cattagtttattatatttttaaattgtt |
23862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University