View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_30 (Length: 232)
Name: NF1456_low_30
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 28545581 - 28545360
Alignment:
| Q |
11 |
catatatttcatgttaggttttccacacttttctccatctcttctgcaccttctttttcaatcttattcacgttatcaataactggaagagaaaatactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
28545581 |
catatatttcatgttaggttttccacacttttctccatctcttctgcaccttctttttcaatcttattcacgttatcaataactgggagagagaatactt |
28545482 |
T |
 |
| Q |
111 |
cacacggaattcccaatgggttcacaatgacaatgtttgtcattggctctagggcatactcctccttcacacttttgttgtaaatagcatatagtaacat |
210 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28545481 |
cacacggaattcctaatgggttcacaataacaatgtttgtcattggctctagggcatactcctccttcacacttttgttgtaaatagcatatagtaacat |
28545382 |
T |
 |
| Q |
211 |
ttgaagtagccctaatatgaaa |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28545381 |
ttgaagtagccctaatatgaaa |
28545360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University