View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1456_low_33 (Length: 221)
Name: NF1456_low_33
Description: NF1456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1456_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 11 - 167
Target Start/End: Original strand, 29967582 - 29967738
Alignment:
| Q |
11 |
gaagaatatgagcccagagttcgttatcggagacgagagatcgccatgacttgcaaacgaggcagagtttggcagcatgtttagggcttaatagtcttgt |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29967582 |
gaagaaaatgagcccagagttcgttatcggagacgagagatcgccatgacttgcaaacgaggcagagtttggcagcatgtttagggcctaatagtcttgt |
29967681 |
T |
 |
| Q |
111 |
gattttgaggagtatttcaggagggagtgagtcaaataaacccaaaggactcggagc |
167 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29967682 |
gattttgaggagtatgtcaggagggagtgagtcaaataaacccaaaggactcggagc |
29967738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University