View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457-2-Insertion-31 (Length: 227)
Name: NF1457-2-Insertion-31
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457-2-Insertion-31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 34332839 - 34333032
Alignment:
| Q |
10 |
tttttcataacacttaccaattaatttaagggcaattttgaaattatataatgattgtggatatattattgcgagtacaacaaatttcagtgttttttgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34332839 |
tttttcataacacttaccaattaatttaagggcaattttgaaattatataatgattgtggatatattattgcgagtacaacaaatttgagtgttttttgt |
34332938 |
T |
|
| Q |
110 |
tatataatatagatgatgtgttcaccaacaatgacttagtttccttaaacatgtgtttataggtttgattttgactcttatgtatataaaaaat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34332939 |
tatataatatagatgatgtgttcaccaacaatgacttagtttccttaaacatgtgttcataggtttgattttgactcttatgtgtataaaaaat |
34333032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University