View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457-2-Insertion-32 (Length: 129)
Name: NF1457-2-Insertion-32
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457-2-Insertion-32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 42635034 - 42634913
Alignment:
| Q |
8 |
ataataataatcaggatcacttgtggagtgaaagatgtttctgcgttttgtgttgatgtgttgttttcccgaatcaatttcgacaatcctatcacttttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42635034 |
ataataataatcaggatcacttgtggagtgaaagatgtttctgcgttttgtgttgatgtgttgttttcccgaatcaatttcgacaatcctatcacttttt |
42634935 |
T |
|
| Q |
108 |
tcgtcactcctgctatatgttc |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42634934 |
tcgtcactcctgctatatgttc |
42634913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University