View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457-2-Insertion-33 (Length: 77)
Name: NF1457-2-Insertion-33
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457-2-Insertion-33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 7131974 - 7132041
Alignment:
| Q |
8 |
atttgaaggtagtactattgattttagagggaataattttgaatatcttccttttggagcaggtagaa |
75 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7131974 |
atttgaaggtagttctattgattttagagggaataattttgaatatcttccttttggagcaggtagaa |
7132041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University