View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1457-2-Insertion-34 (Length: 61)

Name: NF1457-2-Insertion-34
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1457-2-Insertion-34
NF1457-2-Insertion-34
[»] chr7 (2 HSPs)
chr7 (6-61)||(25978900-25978955)
chr7 (10-61)||(25973549-25973600)


Alignment Details
Target: chr7 (Bit Score: 56; Significance: 5e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 6 - 61
Target Start/End: Original strand, 25978900 - 25978955
Alignment:
6 caactgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25978900 caactgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta 25978955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 25973549 - 25973600
Alignment:
10 tgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta 61  Q
    |||||||||||||||||| ||| ||||||||||| | ||||| |||||||||    
25973549 tgcagcagcaaggttgctcttcctcttaattgatttatccttctcttgttta 25973600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University