View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457-2-Insertion-34 (Length: 61)
Name: NF1457-2-Insertion-34
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457-2-Insertion-34 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 5e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 6 - 61
Target Start/End: Original strand, 25978900 - 25978955
Alignment:
| Q |
6 |
caactgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25978900 |
caactgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta |
25978955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 25973549 - 25973600
Alignment:
| Q |
10 |
tgcagcagcaaggttgcttttcttcttaattgatctctccttttcttgttta |
61 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| | ||||| ||||||||| |
|
|
| T |
25973549 |
tgcagcagcaaggttgctcttcctcttaattgatttatccttctcttgttta |
25973600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University