View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457-2-Insertion-4 (Length: 255)
Name: NF1457-2-Insertion-4
Description: NF1457-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457-2-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 92 - 255
Target Start/End: Complemental strand, 11954707 - 11954542
Alignment:
| Q |
92 |
tttttgtattgcagaatagtattaaagtctcaaatactcacaaaactaaccgatgtgatacttaacttttaaaatattag-aaaacaatgaaaaagacaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11954707 |
tttttgtattgcagaatagtattaaagtctgaaatactcacaaaactaaccgatgtggtacttaacttttaaaatattagaaaaacaatgaaaaagacaa |
11954608 |
T |
|
| Q |
191 |
cacataggtagattttt-ggataatagattctttcttcgttgttcagattcaccacatctctttta |
255 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11954607 |
cacataggtagatttttgggataatagattctttcttcattgttcagattcaccacatctctttta |
11954542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University