View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14570_high_5 (Length: 355)
Name: NF14570_high_5
Description: NF14570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14570_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 26 - 312
Target Start/End: Original strand, 37220470 - 37220745
Alignment:
| Q |
26 |
tagggagtagatataacacatgttcttttgccaagaaatcgttcaagaaatccaaaagggaaggaccagaggcatttgtagacctctcagatgacaaatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37220470 |
tagggagtagatataacacatgttcttttgccaag------------aaatccaaaagggaaggaccagaggcatttgtagatctctcagatgacaaatt |
37220557 |
T |
|
| Q |
126 |
tgttcaagatgacaacttattggacacttctcttaatccacctgttgagaatgctaaccctattccttccaggagtgctgtgcttcaggcttgcatactg |
225 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220558 |
tgttcaaaatgacaacttattggacacttctcttaatccacctgttgagaatgctaaccctattccttccaggagtgctgtgcttcaggcttgcatactc |
37220657 |
T |
|
| Q |
226 |
acttcggctctcatagctgctttcgggacagtgattcgccaggttctcgttcaatcagtttctcgctttgttg-atttttccaattct |
312 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
37220658 |
acttctgctctcatagctgctttcgggacagtgattcgccaggttctcgttcattcatcttccaactttgttgcatttttccaattct |
37220745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University